ID: 989697870

View in Genome Browser
Species Human (GRCh38)
Location 5:44224892-44224914
Sequence AGCCCCAAGGATGCCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697870_989697874 1 Left 989697870 5:44224892-44224914 CCTGCCATGGCATCCTTGGGGCT No data
Right 989697874 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
989697870_989697880 28 Left 989697870 5:44224892-44224914 CCTGCCATGGCATCCTTGGGGCT No data
Right 989697880 5:44224943-44224965 GCGCAATGGGAGATAGTTGGAGG No data
989697870_989697877 15 Left 989697870 5:44224892-44224914 CCTGCCATGGCATCCTTGGGGCT No data
Right 989697877 5:44224930-44224952 TCCAAATGGATGTGCGCAATGGG No data
989697870_989697879 25 Left 989697870 5:44224892-44224914 CCTGCCATGGCATCCTTGGGGCT No data
Right 989697879 5:44224940-44224962 TGTGCGCAATGGGAGATAGTTGG No data
989697870_989697876 14 Left 989697870 5:44224892-44224914 CCTGCCATGGCATCCTTGGGGCT No data
Right 989697876 5:44224929-44224951 TTCCAAATGGATGTGCGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697870 Original CRISPR AGCCCCAAGGATGCCATGGC AGG (reversed) Intergenic