ID: 989697871

View in Genome Browser
Species Human (GRCh38)
Location 5:44224896-44224918
Sequence AGGCAGCCCCAAGGATGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697871_989697874 -3 Left 989697871 5:44224896-44224918 CCATGGCATCCTTGGGGCTGCCT No data
Right 989697874 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
989697871_989697880 24 Left 989697871 5:44224896-44224918 CCATGGCATCCTTGGGGCTGCCT No data
Right 989697880 5:44224943-44224965 GCGCAATGGGAGATAGTTGGAGG No data
989697871_989697877 11 Left 989697871 5:44224896-44224918 CCATGGCATCCTTGGGGCTGCCT No data
Right 989697877 5:44224930-44224952 TCCAAATGGATGTGCGCAATGGG No data
989697871_989697876 10 Left 989697871 5:44224896-44224918 CCATGGCATCCTTGGGGCTGCCT No data
Right 989697876 5:44224929-44224951 TTCCAAATGGATGTGCGCAATGG No data
989697871_989697879 21 Left 989697871 5:44224896-44224918 CCATGGCATCCTTGGGGCTGCCT No data
Right 989697879 5:44224940-44224962 TGTGCGCAATGGGAGATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697871 Original CRISPR AGGCAGCCCCAAGGATGCCA TGG (reversed) Intergenic
No off target data available for this crispr