ID: 989697872

View in Genome Browser
Species Human (GRCh38)
Location 5:44224905-44224927
Sequence TGGAAGTCAAGGCAGCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697872_989697881 25 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697881 5:44224953-44224975 AGATAGTTGGAGGAGATCCAAGG No data
989697872_989697880 15 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697880 5:44224943-44224965 GCGCAATGGGAGATAGTTGGAGG No data
989697872_989697879 12 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697879 5:44224940-44224962 TGTGCGCAATGGGAGATAGTTGG No data
989697872_989697882 26 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697882 5:44224954-44224976 GATAGTTGGAGGAGATCCAAGGG No data
989697872_989697876 1 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697876 5:44224929-44224951 TTCCAAATGGATGTGCGCAATGG No data
989697872_989697877 2 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697877 5:44224930-44224952 TCCAAATGGATGTGCGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697872 Original CRISPR TGGAAGTCAAGGCAGCCCCA AGG (reversed) Intergenic