ID: 989697874

View in Genome Browser
Species Human (GRCh38)
Location 5:44224916-44224938
Sequence CCTTGACTTCCACTTCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697870_989697874 1 Left 989697870 5:44224892-44224914 CCTGCCATGGCATCCTTGGGGCT No data
Right 989697874 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
989697864_989697874 19 Left 989697864 5:44224874-44224896 CCCTTTTCTGCTCTGATGCCTGC No data
Right 989697874 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
989697865_989697874 18 Left 989697865 5:44224875-44224897 CCTTTTCTGCTCTGATGCCTGCC No data
Right 989697874 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
989697871_989697874 -3 Left 989697871 5:44224896-44224918 CCATGGCATCCTTGGGGCTGCCT No data
Right 989697874 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
989697863_989697874 29 Left 989697863 5:44224864-44224886 CCATTTTCTGCCCTTTTCTGCTC No data
Right 989697874 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697874 Original CRISPR CCTTGACTTCCACTTCCAAA TGG Intergenic