ID: 989697876

View in Genome Browser
Species Human (GRCh38)
Location 5:44224929-44224951
Sequence TTCCAAATGGATGTGCGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697873_989697876 -10 Left 989697873 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
Right 989697876 5:44224929-44224951 TTCCAAATGGATGTGCGCAATGG No data
989697871_989697876 10 Left 989697871 5:44224896-44224918 CCATGGCATCCTTGGGGCTGCCT No data
Right 989697876 5:44224929-44224951 TTCCAAATGGATGTGCGCAATGG No data
989697870_989697876 14 Left 989697870 5:44224892-44224914 CCTGCCATGGCATCCTTGGGGCT No data
Right 989697876 5:44224929-44224951 TTCCAAATGGATGTGCGCAATGG No data
989697872_989697876 1 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697876 5:44224929-44224951 TTCCAAATGGATGTGCGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697876 Original CRISPR TTCCAAATGGATGTGCGCAA TGG Intergenic