ID: 989697877

View in Genome Browser
Species Human (GRCh38)
Location 5:44224930-44224952
Sequence TCCAAATGGATGTGCGCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697871_989697877 11 Left 989697871 5:44224896-44224918 CCATGGCATCCTTGGGGCTGCCT No data
Right 989697877 5:44224930-44224952 TCCAAATGGATGTGCGCAATGGG No data
989697873_989697877 -9 Left 989697873 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
Right 989697877 5:44224930-44224952 TCCAAATGGATGTGCGCAATGGG No data
989697870_989697877 15 Left 989697870 5:44224892-44224914 CCTGCCATGGCATCCTTGGGGCT No data
Right 989697877 5:44224930-44224952 TCCAAATGGATGTGCGCAATGGG No data
989697872_989697877 2 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697877 5:44224930-44224952 TCCAAATGGATGTGCGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697877 Original CRISPR TCCAAATGGATGTGCGCAAT GGG Intergenic