ID: 989697880

View in Genome Browser
Species Human (GRCh38)
Location 5:44224943-44224965
Sequence GCGCAATGGGAGATAGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697872_989697880 15 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697880 5:44224943-44224965 GCGCAATGGGAGATAGTTGGAGG No data
989697875_989697880 -5 Left 989697875 5:44224925-44224947 CCACTTCCAAATGGATGTGCGCA No data
Right 989697880 5:44224943-44224965 GCGCAATGGGAGATAGTTGGAGG No data
989697871_989697880 24 Left 989697871 5:44224896-44224918 CCATGGCATCCTTGGGGCTGCCT No data
Right 989697880 5:44224943-44224965 GCGCAATGGGAGATAGTTGGAGG No data
989697873_989697880 4 Left 989697873 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
Right 989697880 5:44224943-44224965 GCGCAATGGGAGATAGTTGGAGG No data
989697870_989697880 28 Left 989697870 5:44224892-44224914 CCTGCCATGGCATCCTTGGGGCT No data
Right 989697880 5:44224943-44224965 GCGCAATGGGAGATAGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697880 Original CRISPR GCGCAATGGGAGATAGTTGG AGG Intergenic