ID: 989697881

View in Genome Browser
Species Human (GRCh38)
Location 5:44224953-44224975
Sequence AGATAGTTGGAGGAGATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989697875_989697881 5 Left 989697875 5:44224925-44224947 CCACTTCCAAATGGATGTGCGCA No data
Right 989697881 5:44224953-44224975 AGATAGTTGGAGGAGATCCAAGG No data
989697878_989697881 -1 Left 989697878 5:44224931-44224953 CCAAATGGATGTGCGCAATGGGA No data
Right 989697881 5:44224953-44224975 AGATAGTTGGAGGAGATCCAAGG No data
989697873_989697881 14 Left 989697873 5:44224916-44224938 CCTTGACTTCCACTTCCAAATGG No data
Right 989697881 5:44224953-44224975 AGATAGTTGGAGGAGATCCAAGG No data
989697872_989697881 25 Left 989697872 5:44224905-44224927 CCTTGGGGCTGCCTTGACTTCCA No data
Right 989697881 5:44224953-44224975 AGATAGTTGGAGGAGATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989697881 Original CRISPR AGATAGTTGGAGGAGATCCA AGG Intergenic