ID: 989701448

View in Genome Browser
Species Human (GRCh38)
Location 5:44270086-44270108
Sequence AGGCTTATCTAGAGGACATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989701448_989701452 -4 Left 989701448 5:44270086-44270108 CCGTATGTCCTCTAGATAAGCCT No data
Right 989701452 5:44270105-44270127 GCCTGGCTCATGATTGGTGCCGG No data
989701448_989701451 -10 Left 989701448 5:44270086-44270108 CCGTATGTCCTCTAGATAAGCCT No data
Right 989701451 5:44270099-44270121 AGATAAGCCTGGCTCATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989701448 Original CRISPR AGGCTTATCTAGAGGACATA CGG (reversed) Intergenic
No off target data available for this crispr