ID: 989705894

View in Genome Browser
Species Human (GRCh38)
Location 5:44329829-44329851
Sequence TTGTTTGCCCAGATTCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989705894_989705896 14 Left 989705894 5:44329829-44329851 CCCTACTGAATCTGGGCAAACAA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 989705896 5:44329866-44329888 TAAATTCCTCTTCCTATAATAGG 0: 1
1: 0
2: 2
3: 17
4: 225
989705894_989705898 22 Left 989705894 5:44329829-44329851 CCCTACTGAATCTGGGCAAACAA 0: 1
1: 0
2: 0
3: 7
4: 142
Right 989705898 5:44329874-44329896 TCTTCCTATAATAGGCAGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989705894 Original CRISPR TTGTTTGCCCAGATTCAGTA GGG (reversed) Intronic
903297726 1:22355832-22355854 TTGGTTCCCCAGTTTCAGCAGGG + Intergenic
905144350 1:35875955-35875977 TACTTTGCCCAGATCCATTATGG - Intronic
908940825 1:69431482-69431504 CTGTTTCCCCAAAGTCAGTAAGG + Intergenic
910418921 1:87034388-87034410 TGGTTTTCCCAGATTCTGGAGGG + Intronic
913321530 1:117591964-117591986 GTGTATGGCCAGATTCAGTCAGG + Intergenic
916868027 1:168881804-168881826 TTACTTGCCCAAATTCAGTCAGG - Intergenic
921007072 1:211104515-211104537 TTTTTAGACCAGATTCAGTGTGG - Intronic
921235138 1:213119112-213119134 TTGTTCTCACAGAATCAGTATGG - Intronic
921394972 1:214658955-214658977 TTCTTTGCCGAGACTCAGTGGGG - Exonic
923070007 1:230554792-230554814 TTGTTTGCATAAATTCAATAAGG - Intergenic
923440088 1:234009500-234009522 TTATTTGCCCTGATTCAAAAAGG - Intronic
1070932269 10:80269816-80269838 TTTTTTCCCCAGCTTCATTAAGG - Intergenic
1071243928 10:83741782-83741804 TTGCTTCCACATATTCAGTATGG + Intergenic
1074961312 10:118448465-118448487 TTGTTTGCCAAGAAGCAGTCAGG - Intergenic
1078820522 11:14876208-14876230 ATGTTTGTCAAGATTCAGGAAGG + Intergenic
1080251770 11:30241631-30241653 CTGTTTCCCCAGATGCATTAAGG - Intergenic
1082231260 11:49769674-49769696 TTGTTTGCTCATATTAAGAAGGG - Intergenic
1089709593 11:120305572-120305594 TTGTTTGCCCACATCCTGCATGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090988649 11:131796163-131796185 TTGTTTCCCCAGCTGCAGGAGGG - Intronic
1091462747 12:657614-657636 TTTTTTGCCCATATTTAGTGGGG - Intronic
1092705723 12:11282320-11282342 ATGTTTGATCAGATTCAGTTTGG + Intergenic
1092710491 12:11331682-11331704 ATGTTTGATCAGATTCAGTTTGG + Intergenic
1097332668 12:58349292-58349314 TTGTTTGTGCAGATGCAGTTGGG + Intergenic
1100784195 12:98062022-98062044 CTGTCTGCCCAGATGCAGAAAGG + Intergenic
1104360917 12:128132471-128132493 CTGTTTCCCCATATTCAGAATGG - Intergenic
1104397394 12:128446106-128446128 TTGCCTTCTCAGATTCAGTAAGG + Intronic
1106379052 13:29218514-29218536 TACTTTGCCCAGATCCATTAAGG + Intronic
1110215075 13:73016498-73016520 TTGTTGGACCAGATGCAATATGG + Intergenic
1111267235 13:85832848-85832870 TTGTTTGCCCAGGATCACGATGG + Intergenic
1111620056 13:90713714-90713736 TGAGTTCCCCAGATTCAGTAGGG - Intergenic
1114161674 14:20175183-20175205 TTGTTTGCGCAGGTTCAGTGAGG - Intergenic
1114803929 14:25811960-25811982 TTGTTGGCCCTGACTCACTATGG - Intergenic
1114936556 14:27546365-27546387 TTGTTGGCCCAGATTTATTAAGG - Intergenic
1116592274 14:46793224-46793246 TACTTTGCCCAGATTTATTAAGG + Intergenic
1116818033 14:49600966-49600988 TTCTTTGTGCAGATTCTGTAAGG - Intronic
1117540991 14:56746355-56746377 TTGTTTCCCTATATTCAGCAGGG - Intergenic
1127628409 15:60802749-60802771 ATCTTTGCCCAGATTCAATAAGG + Intronic
1128897059 15:71384411-71384433 TTGTGTGCCTGGATTCAGCATGG + Intronic
1138138614 16:54546704-54546726 TTGTTTGGGCAACTTCAGTAGGG - Intergenic
1138784434 16:59829591-59829613 ATGTTTGCCAAGATGTAGTAAGG - Intergenic
1145189307 17:20824441-20824463 TAATTTGCCATGATTCAGTATGG - Intergenic
1145241864 17:21244837-21244859 TTGTTTGCCCAGCAGCAGTTTGG - Intronic
1149494967 17:57111582-57111604 TTGTTTCCCCATATACAGAATGG + Intronic
1150077591 17:62206511-62206533 TAATTTGCCATGATTCAGTATGG + Intergenic
1154462523 18:14608074-14608096 TTGTTTGCCCACAATAATTATGG - Intergenic
1156380926 18:36560399-36560421 TTGTTTGGCAAGAGGCAGTAGGG + Intronic
1156634986 18:39016675-39016697 TTTTTTGCCCAGATCCATCAGGG + Intergenic
1157232410 18:45930436-45930458 TTGTTGCACCAGTTTCAGTAAGG - Intronic
1164285692 19:23814397-23814419 TTATTTGGCCATATTCAGAAGGG + Intronic
1165700782 19:37935839-37935861 GAGTCAGCCCAGATTCAGTATGG + Intronic
1166443463 19:42836991-42837013 TTATTTGCACAACTTCAGTAAGG - Intronic
925272463 2:2622167-2622189 TTGATTGCCCAGATTCATGATGG + Intergenic
925651288 2:6092178-6092200 CTATTTGCCCAGAGTCAGGATGG - Intergenic
929365733 2:41154464-41154486 TTGTTTTGCAAGCTTCAGTATGG + Intergenic
929895257 2:45954165-45954187 TTCCTTGCCAAGATTCACTAGGG - Intronic
929971507 2:46581436-46581458 TTCTTTGTGCAGATTCTGTAAGG - Exonic
932719707 2:74130147-74130169 TTGTTTGACCATAGTCACTATGG + Intergenic
933226970 2:79761059-79761081 TTGTTTTCCCAAATTCATTCTGG - Intronic
933343722 2:81055437-81055459 TTGTTTGCCCATTTACAATATGG + Intergenic
935277646 2:101489171-101489193 TTCTTTGACCATATTCAGCATGG + Intergenic
938300937 2:130212498-130212520 TTCTTTGTGCAGATTCTGTAAGG + Intergenic
938455780 2:131461970-131461992 TTCTTTGTGCAGATTCTGTAAGG - Intergenic
942265630 2:174222125-174222147 TTGTTTGCCTAGAATCAGGTTGG - Intronic
942493452 2:176512879-176512901 ATCTTTGCACAGATCCAGTATGG - Intergenic
942866341 2:180679968-180679990 TTGTTGGCCAAGATTCTGTCAGG + Intergenic
947486963 2:230559375-230559397 TTGTTTGTACAGATTCATCATGG - Intergenic
948629707 2:239294252-239294274 TTCTGTGCCCAGGTTCAGAAGGG - Intronic
1175151815 20:56940917-56940939 TCATTTGCCCAAATTCAGTGAGG - Intergenic
1175599860 20:60264495-60264517 ATGTTTGCCCTGATTTAGTGGGG + Intergenic
1176811995 21:13550308-13550330 TTGTTTGCCCACAATAATTATGG + Intergenic
1177722973 21:24931072-24931094 TTGGGTGCCCAGAATCACTAAGG + Intergenic
1178217782 21:30621111-30621133 TTGTTTTCTCATATTCAGGATGG + Intergenic
1178386975 21:32160423-32160445 TAGTTTGCCAAGATTGAGGATGG + Intergenic
1178736793 21:35159873-35159895 TTGTTTCCCCAAATTCAGAATGG - Intronic
1180819895 22:18819645-18819667 TTCTTTGCCCAGATGCTTTATGG - Intergenic
1182840175 22:33382744-33382766 TTGTATGCCCATGTCCAGTAAGG - Intronic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
952878850 3:37970596-37970618 TTGTTTCCCCAGATTCATTCAGG + Intronic
957825122 3:85431713-85431735 TTGTTTGCTGAGAGTCAGAAGGG + Intronic
958729815 3:97949692-97949714 TCGTCTGCCCATATTCACTAAGG + Intronic
961992198 3:131204156-131204178 GAGTTTGCCCAGATTCTGGATGG + Intronic
963398411 3:144763811-144763833 TTGTATGCCCAGATGGAATATGG - Intergenic
963978184 3:151506280-151506302 TTGTATGCCTGGATTCAGCATGG - Intergenic
969245979 4:5933314-5933336 ATCTTTTCCCAGAATCAGTAGGG - Intronic
969978650 4:11131444-11131466 TTCTTTGCCATGCTTCAGTATGG + Intergenic
971977785 4:33712761-33712783 TATTTTGCCCAGATCCATTAGGG + Intergenic
972235499 4:37129097-37129119 TTATTTGCCAAGTTTCATTAAGG - Intergenic
972724345 4:41733108-41733130 GTGTATGACCAGATGCAGTAGGG + Intergenic
974522974 4:63009404-63009426 TTGTATGCCGAGACTCAGCATGG - Intergenic
976784819 4:88806314-88806336 TTGCTTTCCCAGATGCGGTAAGG - Intronic
977029805 4:91867768-91867790 TTCTATGCTCAGAATCAGTATGG - Intergenic
978202465 4:106038209-106038231 TTGTTTACCCAGATCCTGGAAGG - Intergenic
979118553 4:116861101-116861123 TTATCTGCCTAGTTTCAGTAAGG + Intergenic
979734552 4:124066277-124066299 TTCTTTTAACAGATTCAGTATGG + Intergenic
982940182 4:161540707-161540729 TTTTTTGGCCAGATTCTGAAAGG - Intronic
983884240 4:172962730-172962752 TTGTTTACCCAGAATCAGGCTGG - Intronic
986377439 5:7147034-7147056 TTGTTTTTCCACTTTCAGTAGGG - Intergenic
986624479 5:9710479-9710501 TTGTTTGCCCATTTTTGGTAGGG - Intronic
989705894 5:44329829-44329851 TTGTTTGCCCAGATTCAGTAGGG - Intronic
990834812 5:60005637-60005659 TTGTTTCCCCAGCTTTATTAAGG - Intronic
992315405 5:75547818-75547840 GTGTTGGCACAGTTTCAGTATGG - Intronic
993503057 5:88683574-88683596 TTGTTTGCCGAGATCAAGAAAGG - Intergenic
994131503 5:96234455-96234477 TTGGTTGACCTGATTTAGTATGG - Intergenic
999038544 5:148381674-148381696 TTATCTGCCCTGATTCTGTAGGG - Intergenic
999357532 5:150950334-150950356 AGGTTTTCCCACATTCAGTAAGG + Intergenic
1002392134 5:178922741-178922763 TTCTTTGTGCAGATTCTGTAAGG + Intronic
1002882371 6:1264264-1264286 TTGTTAGGACAGATTAAGTAAGG - Intergenic
1005034062 6:21539534-21539556 TTGCTTGCCCAAATTCAAAAGGG - Intergenic
1007243943 6:40446624-40446646 TTATTTACTCAGATTCTGTATGG - Intronic
1013716772 6:112971279-112971301 TATTTTTCCCAGATTCATTAGGG - Intergenic
1014593964 6:123309377-123309399 TACTTGGCCCAGTTTCAGTATGG - Intronic
1015908289 6:138140552-138140574 TTGTAAGCCCATATTAAGTATGG - Intergenic
1022949652 7:35324329-35324351 TTTTTTGCCTATATTCATTAGGG + Intergenic
1026034792 7:66823231-66823253 CAGTTTGCCCAGATGCAGAATGG - Intergenic
1026771055 7:73199308-73199330 TTTTTTTCCCAGATGGAGTATGG - Intergenic
1027011923 7:74752705-74752727 TTTTTTTCCCAGATGGAGTATGG - Intronic
1027076118 7:75193346-75193368 TTTTTTTCCCAGATGGAGTATGG + Intergenic
1028025322 7:85829857-85829879 TTGTTTGCCCAGAATGAGCATGG + Intergenic
1029370502 7:100147759-100147781 TTTTGTCCCCAGATTCAGTCCGG - Intergenic
1030545626 7:110891541-110891563 TTGTTTGTCCTGACTCACTAAGG - Intronic
1031206307 7:118762506-118762528 TTGTTTCCCTATCTTCAGTATGG - Intergenic
1037413525 8:18622574-18622596 TTTTTTCCCCAGCTTTAGTAAGG + Intronic
1037603634 8:20419643-20419665 TTGTTTCCCCTGATTCTCTAGGG + Intergenic
1037732220 8:21535954-21535976 TTTTTTCCCCAGTTTCAGCAAGG - Intergenic
1039745611 8:40423415-40423437 TTGTTTCCTCAACTTCAGTATGG + Intergenic
1041942306 8:63402242-63402264 TTCTATGGCCAGATTCATTAAGG + Intergenic
1042764525 8:72306324-72306346 TTGTTTACCCAAAGTCAGTCAGG + Intergenic
1043919187 8:85961813-85961835 AAGTTTGCCCAAATTCAGGATGG - Intergenic
1046536067 8:115512149-115512171 TTGTTTGCCAAGTTTCAGCTTGG - Intronic
1048085580 8:131174820-131174842 CTGTTTACACATATTCAGTAAGG + Intergenic
1048285720 8:133139915-133139937 TTGTCTCCCCAGCTTCAGTGAGG - Intergenic
1048947115 8:139459710-139459732 ATTTTTGTCCATATTCAGTATGG - Intergenic
1051493666 9:17695457-17695479 TTATTTTCCCTGAGTCAGTAAGG + Intronic
1052702671 9:31957333-31957355 TTATTTGCCCATTTTCATTAGGG - Intergenic
1058686341 9:107484168-107484190 TTGTTTTCCCACCTTCAGTCAGG + Intergenic
1060070366 9:120541851-120541873 GTGTTAGCCCAGATTCTGCAAGG - Intronic
1060152416 9:121297061-121297083 TTGCTGGCCCAGGTTCAGTCTGG + Intronic
1062251375 9:135597035-135597057 TTGTTGGCCCAGGTTTAGGAGGG + Intergenic
1190154496 X:47977489-47977511 TTGTTTTCTCATACTCAGTATGG + Exonic
1191052042 X:56204595-56204617 TTGTTTCCCCAGTTTCTTTAGGG + Intergenic
1194742329 X:97588743-97588765 TTTTCTGCCCTGTTTCAGTAAGG - Intronic
1195472235 X:105243772-105243794 TTGTATGCCTAGACTCAGCATGG + Intronic
1196798660 X:119522830-119522852 TTGGTTTCCCAGCTTCAGAATGG - Intergenic
1198260761 X:134962767-134962789 TTATTGGCTCAGATTCCGTAGGG + Intergenic
1198600613 X:138281349-138281371 TTTATTGCTCAGATTAAGTATGG - Intergenic
1198698301 X:139367550-139367572 TTGTTTTCCCAGCTTTATTAAGG + Intergenic
1199157328 X:144565960-144565982 TTGTTTGCTCAGATTCACAGAGG - Intergenic
1199656595 X:150001936-150001958 ATGTTTGCACAGACTCACTATGG - Intergenic
1199830112 X:151540679-151540701 TTTTTTCCCCAGCTTCAGTGAGG + Intergenic