ID: 989711069

View in Genome Browser
Species Human (GRCh38)
Location 5:44398006-44398028
Sequence CCTCTGCCTAGAAAAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989711066_989711069 -6 Left 989711066 5:44397989-44398011 CCATTTTCTGACACAATCCTCTG No data
Right 989711069 5:44398006-44398028 CCTCTGCCTAGAAAAGCCCTGGG No data
989711063_989711069 21 Left 989711063 5:44397962-44397984 CCCAAGTGGCAAAGCCAGCATTT No data
Right 989711069 5:44398006-44398028 CCTCTGCCTAGAAAAGCCCTGGG No data
989711064_989711069 20 Left 989711064 5:44397963-44397985 CCAAGTGGCAAAGCCAGCATTTA No data
Right 989711069 5:44398006-44398028 CCTCTGCCTAGAAAAGCCCTGGG No data
989711065_989711069 7 Left 989711065 5:44397976-44397998 CCAGCATTTATTTCCATTTTCTG No data
Right 989711069 5:44398006-44398028 CCTCTGCCTAGAAAAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989711069 Original CRISPR CCTCTGCCTAGAAAAGCCCT GGG Intergenic
No off target data available for this crispr