ID: 989711347

View in Genome Browser
Species Human (GRCh38)
Location 5:44401063-44401085
Sequence TACTGTTTGCTGTAAAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989711347_989711348 -4 Left 989711347 5:44401063-44401085 CCAATATTTTACAGCAAACAGTA No data
Right 989711348 5:44401082-44401104 AGTAAAATTTTGTTGTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989711347 Original CRISPR TACTGTTTGCTGTAAAATAT TGG (reversed) Intergenic
No off target data available for this crispr