ID: 989714374

View in Genome Browser
Species Human (GRCh38)
Location 5:44443633-44443655
Sequence AGCAGTCATGTCTCATTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989714370_989714374 6 Left 989714370 5:44443604-44443626 CCAAATTGCAACTTTGTGAAGTC No data
Right 989714374 5:44443633-44443655 AGCAGTCATGTCTCATTCCATGG No data
989714368_989714374 24 Left 989714368 5:44443586-44443608 CCATCACCACTACTCAGGCCAAA No data
Right 989714374 5:44443633-44443655 AGCAGTCATGTCTCATTCCATGG No data
989714369_989714374 18 Left 989714369 5:44443592-44443614 CCACTACTCAGGCCAAATTGCAA No data
Right 989714374 5:44443633-44443655 AGCAGTCATGTCTCATTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989714374 Original CRISPR AGCAGTCATGTCTCATTCCA TGG Intergenic
No off target data available for this crispr