ID: 989714443

View in Genome Browser
Species Human (GRCh38)
Location 5:44444664-44444686
Sequence GTTACTATGCTGAATATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989714443_989714448 11 Left 989714443 5:44444664-44444686 CCTACCATATTCAGCATAGTAAC No data
Right 989714448 5:44444698-44444720 GTTTGTAGCCTAGGAGGAATAGG No data
989714443_989714446 2 Left 989714443 5:44444664-44444686 CCTACCATATTCAGCATAGTAAC No data
Right 989714446 5:44444689-44444711 GCTGTATAGGTTTGTAGCCTAGG 0: 48
1: 610
2: 1334
3: 1422
4: 1186
989714443_989714450 30 Left 989714443 5:44444664-44444686 CCTACCATATTCAGCATAGTAAC No data
Right 989714450 5:44444717-44444739 TAGGCTAAACCATATAGCCTAGG No data
989714443_989714447 5 Left 989714443 5:44444664-44444686 CCTACCATATTCAGCATAGTAAC No data
Right 989714447 5:44444692-44444714 GTATAGGTTTGTAGCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989714443 Original CRISPR GTTACTATGCTGAATATGGT AGG (reversed) Intergenic
No off target data available for this crispr