ID: 989714446

View in Genome Browser
Species Human (GRCh38)
Location 5:44444689-44444711
Sequence GCTGTATAGGTTTGTAGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4600
Summary {0: 48, 1: 610, 2: 1334, 3: 1422, 4: 1186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989714443_989714446 2 Left 989714443 5:44444664-44444686 CCTACCATATTCAGCATAGTAAC No data
Right 989714446 5:44444689-44444711 GCTGTATAGGTTTGTAGCCTAGG 0: 48
1: 610
2: 1334
3: 1422
4: 1186
989714442_989714446 19 Left 989714442 5:44444647-44444669 CCATTGTATTACAATTGCCTACC 0: 2
1: 27
2: 392
3: 1049
4: 1508
Right 989714446 5:44444689-44444711 GCTGTATAGGTTTGTAGCCTAGG 0: 48
1: 610
2: 1334
3: 1422
4: 1186
989714444_989714446 -2 Left 989714444 5:44444668-44444690 CCATATTCAGCATAGTAACATGC No data
Right 989714446 5:44444689-44444711 GCTGTATAGGTTTGTAGCCTAGG 0: 48
1: 610
2: 1334
3: 1422
4: 1186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989714446 Original CRISPR GCTGTATAGGTTTGTAGCCT AGG Intergenic
Too many off-targets to display for this crispr