ID: 989714447

View in Genome Browser
Species Human (GRCh38)
Location 5:44444692-44444714
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989714444_989714447 1 Left 989714444 5:44444668-44444690 CCATATTCAGCATAGTAACATGC No data
Right 989714447 5:44444692-44444714 GTATAGGTTTGTAGCCTAGGAGG No data
989714443_989714447 5 Left 989714443 5:44444664-44444686 CCTACCATATTCAGCATAGTAAC No data
Right 989714447 5:44444692-44444714 GTATAGGTTTGTAGCCTAGGAGG No data
989714442_989714447 22 Left 989714442 5:44444647-44444669 CCATTGTATTACAATTGCCTACC 0: 2
1: 27
2: 392
3: 1049
4: 1508
Right 989714447 5:44444692-44444714 GTATAGGTTTGTAGCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr