ID: 989714450

View in Genome Browser
Species Human (GRCh38)
Location 5:44444717-44444739
Sequence TAGGCTAAACCATATAGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989714444_989714450 26 Left 989714444 5:44444668-44444690 CCATATTCAGCATAGTAACATGC No data
Right 989714450 5:44444717-44444739 TAGGCTAAACCATATAGCCTAGG No data
989714443_989714450 30 Left 989714443 5:44444664-44444686 CCTACCATATTCAGCATAGTAAC No data
Right 989714450 5:44444717-44444739 TAGGCTAAACCATATAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989714450 Original CRISPR TAGGCTAAACCATATAGCCT AGG Intergenic
No off target data available for this crispr