ID: 989715702

View in Genome Browser
Species Human (GRCh38)
Location 5:44459620-44459642
Sequence TATGATCCTGAAAGTCGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989715700_989715702 -5 Left 989715700 5:44459602-44459624 CCTCAACCACATGGATTATATGA No data
Right 989715702 5:44459620-44459642 TATGATCCTGAAAGTCGTCATGG No data
989715694_989715702 26 Left 989715694 5:44459571-44459593 CCAAATGAAATTCTGGAACCTTG No data
Right 989715702 5:44459620-44459642 TATGATCCTGAAAGTCGTCATGG No data
989715697_989715702 3 Left 989715697 5:44459594-44459616 CCTTCCCACCTCAACCACATGGA No data
Right 989715702 5:44459620-44459642 TATGATCCTGAAAGTCGTCATGG No data
989715699_989715702 -2 Left 989715699 5:44459599-44459621 CCACCTCAACCACATGGATTATA No data
Right 989715702 5:44459620-44459642 TATGATCCTGAAAGTCGTCATGG No data
989715698_989715702 -1 Left 989715698 5:44459598-44459620 CCCACCTCAACCACATGGATTAT No data
Right 989715702 5:44459620-44459642 TATGATCCTGAAAGTCGTCATGG No data
989715695_989715702 8 Left 989715695 5:44459589-44459611 CCTTGCCTTCCCACCTCAACCAC No data
Right 989715702 5:44459620-44459642 TATGATCCTGAAAGTCGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989715702 Original CRISPR TATGATCCTGAAAGTCGTCA TGG Intergenic
No off target data available for this crispr