ID: 989717696

View in Genome Browser
Species Human (GRCh38)
Location 5:44483491-44483513
Sequence CAGCAAATAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989717696_989717703 19 Left 989717696 5:44483491-44483513 CCGTCCACCACTGCTATTTGCTG No data
Right 989717703 5:44483533-44483555 GACTTCCACCCCTCTGGATCCGG 0: 28
1: 72
2: 82
3: 94
4: 145
989717696_989717706 24 Left 989717696 5:44483491-44483513 CCGTCCACCACTGCTATTTGCTG No data
Right 989717706 5:44483538-44483560 CCACCCCTCTGGATCCGGAAGGG No data
989717696_989717702 13 Left 989717696 5:44483491-44483513 CCGTCCACCACTGCTATTTGCTG No data
Right 989717702 5:44483527-44483549 GCTGCTGACTTCCACCCCTCTGG No data
989717696_989717704 23 Left 989717696 5:44483491-44483513 CCGTCCACCACTGCTATTTGCTG No data
Right 989717704 5:44483537-44483559 TCCACCCCTCTGGATCCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989717696 Original CRISPR CAGCAAATAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr