ID: 989718410

View in Genome Browser
Species Human (GRCh38)
Location 5:44493538-44493560
Sequence GGTTAGGTTTAGAACTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989718410_989718415 28 Left 989718410 5:44493538-44493560 CCATTCTAGTTCTAAACCTAACC No data
Right 989718415 5:44493589-44493611 TCTGCCAAGGTTATTTGCCTTGG No data
989718410_989718416 29 Left 989718410 5:44493538-44493560 CCATTCTAGTTCTAAACCTAACC No data
Right 989718416 5:44493590-44493612 CTGCCAAGGTTATTTGCCTTGGG No data
989718410_989718413 15 Left 989718410 5:44493538-44493560 CCATTCTAGTTCTAAACCTAACC No data
Right 989718413 5:44493576-44493598 AAATCTTCCTATTTCTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989718410 Original CRISPR GGTTAGGTTTAGAACTAGAA TGG (reversed) Intergenic
No off target data available for this crispr