ID: 989719254

View in Genome Browser
Species Human (GRCh38)
Location 5:44504834-44504856
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989719254_989719257 7 Left 989719254 5:44504834-44504856 CCTCAGGGCTTATTACCCAGGGC No data
Right 989719257 5:44504864-44504886 AGTCCCTATTCCCCAAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989719254 Original CRISPR GCCCTGGGTAATAAGCCCTG AGG (reversed) Intergenic
No off target data available for this crispr