ID: 989726483

View in Genome Browser
Species Human (GRCh38)
Location 5:44593162-44593184
Sequence CATTAAATACATAAATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989726483_989726486 18 Left 989726483 5:44593162-44593184 CCTTCAAATTTATGTATTTAATG No data
Right 989726486 5:44593203-44593225 GCATCAGCAATGTTGTCTGTTGG No data
989726483_989726484 -4 Left 989726483 5:44593162-44593184 CCTTCAAATTTATGTATTTAATG No data
Right 989726484 5:44593181-44593203 AATGACTTTTAGTAAAGCCTTGG No data
989726483_989726487 19 Left 989726483 5:44593162-44593184 CCTTCAAATTTATGTATTTAATG No data
Right 989726487 5:44593204-44593226 CATCAGCAATGTTGTCTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989726483 Original CRISPR CATTAAATACATAAATTTGA AGG (reversed) Intergenic
No off target data available for this crispr