ID: 989736052

View in Genome Browser
Species Human (GRCh38)
Location 5:44708108-44708130
Sequence TCTGGGGACCACTACTATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989736046_989736052 4 Left 989736046 5:44708081-44708103 CCACAAAACCTCTCTGGTGCCAA No data
Right 989736052 5:44708108-44708130 TCTGGGGACCACTACTATAGAGG No data
989736047_989736052 -4 Left 989736047 5:44708089-44708111 CCTCTCTGGTGCCAAAAAGTCTG No data
Right 989736052 5:44708108-44708130 TCTGGGGACCACTACTATAGAGG No data
989736044_989736052 27 Left 989736044 5:44708058-44708080 CCTGTCTATGGAAACATTTTCTT No data
Right 989736052 5:44708108-44708130 TCTGGGGACCACTACTATAGAGG No data
989736043_989736052 28 Left 989736043 5:44708057-44708079 CCCTGTCTATGGAAACATTTTCT No data
Right 989736052 5:44708108-44708130 TCTGGGGACCACTACTATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989736052 Original CRISPR TCTGGGGACCACTACTATAG AGG Intergenic
No off target data available for this crispr