ID: 989736221

View in Genome Browser
Species Human (GRCh38)
Location 5:44710134-44710156
Sequence TTTTGTGTGGGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989736221_989736229 -4 Left 989736221 5:44710134-44710156 CCTTCCACCTTCCCCACACAAAA No data
Right 989736229 5:44710153-44710175 AAAACCCTGAAATAATGGGCAGG No data
989736221_989736230 -3 Left 989736221 5:44710134-44710156 CCTTCCACCTTCCCCACACAAAA No data
Right 989736230 5:44710154-44710176 AAACCCTGAAATAATGGGCAGGG No data
989736221_989736227 -9 Left 989736221 5:44710134-44710156 CCTTCCACCTTCCCCACACAAAA No data
Right 989736227 5:44710148-44710170 CACACAAAACCCTGAAATAATGG No data
989736221_989736228 -8 Left 989736221 5:44710134-44710156 CCTTCCACCTTCCCCACACAAAA No data
Right 989736228 5:44710149-44710171 ACACAAAACCCTGAAATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989736221 Original CRISPR TTTTGTGTGGGGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr