ID: 989736227

View in Genome Browser
Species Human (GRCh38)
Location 5:44710148-44710170
Sequence CACACAAAACCCTGAAATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989736219_989736227 27 Left 989736219 5:44710098-44710120 CCTGGCTTACTTATTTTATCTTC No data
Right 989736227 5:44710148-44710170 CACACAAAACCCTGAAATAATGG No data
989736221_989736227 -9 Left 989736221 5:44710134-44710156 CCTTCCACCTTCCCCACACAAAA No data
Right 989736227 5:44710148-44710170 CACACAAAACCCTGAAATAATGG No data
989736220_989736227 3 Left 989736220 5:44710122-44710144 CCTACTCTAGCTCCTTCCACCTT No data
Right 989736227 5:44710148-44710170 CACACAAAACCCTGAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989736227 Original CRISPR CACACAAAACCCTGAAATAA TGG Intergenic
No off target data available for this crispr