ID: 989736228

View in Genome Browser
Species Human (GRCh38)
Location 5:44710149-44710171
Sequence ACACAAAACCCTGAAATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989736220_989736228 4 Left 989736220 5:44710122-44710144 CCTACTCTAGCTCCTTCCACCTT No data
Right 989736228 5:44710149-44710171 ACACAAAACCCTGAAATAATGGG No data
989736219_989736228 28 Left 989736219 5:44710098-44710120 CCTGGCTTACTTATTTTATCTTC No data
Right 989736228 5:44710149-44710171 ACACAAAACCCTGAAATAATGGG No data
989736221_989736228 -8 Left 989736221 5:44710134-44710156 CCTTCCACCTTCCCCACACAAAA No data
Right 989736228 5:44710149-44710171 ACACAAAACCCTGAAATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989736228 Original CRISPR ACACAAAACCCTGAAATAAT GGG Intergenic
No off target data available for this crispr