ID: 989736229

View in Genome Browser
Species Human (GRCh38)
Location 5:44710153-44710175
Sequence AAAACCCTGAAATAATGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989736221_989736229 -4 Left 989736221 5:44710134-44710156 CCTTCCACCTTCCCCACACAAAA No data
Right 989736229 5:44710153-44710175 AAAACCCTGAAATAATGGGCAGG No data
989736220_989736229 8 Left 989736220 5:44710122-44710144 CCTACTCTAGCTCCTTCCACCTT No data
Right 989736229 5:44710153-44710175 AAAACCCTGAAATAATGGGCAGG No data
989736222_989736229 -8 Left 989736222 5:44710138-44710160 CCACCTTCCCCACACAAAACCCT No data
Right 989736229 5:44710153-44710175 AAAACCCTGAAATAATGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989736229 Original CRISPR AAAACCCTGAAATAATGGGC AGG Intergenic
No off target data available for this crispr