ID: 989736230

View in Genome Browser
Species Human (GRCh38)
Location 5:44710154-44710176
Sequence AAACCCTGAAATAATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989736222_989736230 -7 Left 989736222 5:44710138-44710160 CCACCTTCCCCACACAAAACCCT No data
Right 989736230 5:44710154-44710176 AAACCCTGAAATAATGGGCAGGG No data
989736220_989736230 9 Left 989736220 5:44710122-44710144 CCTACTCTAGCTCCTTCCACCTT No data
Right 989736230 5:44710154-44710176 AAACCCTGAAATAATGGGCAGGG No data
989736223_989736230 -10 Left 989736223 5:44710141-44710163 CCTTCCCCACACAAAACCCTGAA No data
Right 989736230 5:44710154-44710176 AAACCCTGAAATAATGGGCAGGG No data
989736221_989736230 -3 Left 989736221 5:44710134-44710156 CCTTCCACCTTCCCCACACAAAA No data
Right 989736230 5:44710154-44710176 AAACCCTGAAATAATGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989736230 Original CRISPR AAACCCTGAAATAATGGGCA GGG Intergenic
No off target data available for this crispr