ID: 989741891

View in Genome Browser
Species Human (GRCh38)
Location 5:44783539-44783561
Sequence CCTGATCCAGACCCCAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989741887_989741891 27 Left 989741887 5:44783489-44783511 CCAAACTCACACAACTTATTAAA No data
Right 989741891 5:44783539-44783561 CCTGATCCAGACCCCAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989741891 Original CRISPR CCTGATCCAGACCCCAAGTG AGG Intergenic
No off target data available for this crispr