ID: 989747462

View in Genome Browser
Species Human (GRCh38)
Location 5:44847131-44847153
Sequence ATGAATATAAATAACCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989747456_989747462 -1 Left 989747456 5:44847109-44847131 CCTTCATTCCCTTCCTGGCTGAA No data
Right 989747462 5:44847131-44847153 ATGAATATAAATAACCAGGTGGG No data
989747458_989747462 -10 Left 989747458 5:44847118-44847140 CCTTCCTGGCTGAATGAATATAA No data
Right 989747462 5:44847131-44847153 ATGAATATAAATAACCAGGTGGG No data
989747457_989747462 -9 Left 989747457 5:44847117-44847139 CCCTTCCTGGCTGAATGAATATA No data
Right 989747462 5:44847131-44847153 ATGAATATAAATAACCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989747462 Original CRISPR ATGAATATAAATAACCAGGT GGG Intergenic
No off target data available for this crispr