ID: 989750232

View in Genome Browser
Species Human (GRCh38)
Location 5:44884108-44884130
Sequence GCAGGGTCCGCGGGCCACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750232_989750237 -3 Left 989750232 5:44884108-44884130 CCAGCGTGGCCCGCGGACCCTGC No data
Right 989750237 5:44884128-44884150 TGCGCACCCTCTGCAGCTGCTGG No data
989750232_989750241 25 Left 989750232 5:44884108-44884130 CCAGCGTGGCCCGCGGACCCTGC No data
Right 989750241 5:44884156-44884178 GTGCTAAGCCCCTGCCTGCCCGG No data
989750232_989750242 26 Left 989750232 5:44884108-44884130 CCAGCGTGGCCCGCGGACCCTGC No data
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data
989750232_989750239 3 Left 989750232 5:44884108-44884130 CCAGCGTGGCCCGCGGACCCTGC No data
Right 989750239 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
989750232_989750244 30 Left 989750232 5:44884108-44884130 CCAGCGTGGCCCGCGGACCCTGC No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data
989750232_989750243 27 Left 989750232 5:44884108-44884130 CCAGCGTGGCCCGCGGACCCTGC No data
Right 989750243 5:44884158-44884180 GCTAAGCCCCTGCCTGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750232 Original CRISPR GCAGGGTCCGCGGGCCACGC TGG (reversed) Intergenic