ID: 989750234

View in Genome Browser
Species Human (GRCh38)
Location 5:44884118-44884140
Sequence CAGAGGGTGCGCAGGGTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750234_989750243 17 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750243 5:44884158-44884180 GCTAAGCCCCTGCCTGCCCGGGG No data
989750234_989750246 23 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750246 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
989750234_989750241 15 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750241 5:44884156-44884178 GTGCTAAGCCCCTGCCTGCCCGG No data
989750234_989750244 20 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data
989750234_989750250 29 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750250 5:44884170-44884192 CCTGCCCGGGGTGGAGGCCCCGG No data
989750234_989750242 16 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data
989750234_989750239 -7 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750239 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750234 Original CRISPR CAGAGGGTGCGCAGGGTCCG CGG (reversed) Intergenic