ID: 989750238

View in Genome Browser
Species Human (GRCh38)
Location 5:44884134-44884156
Sequence CCTGCGCCAGCAGCTGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750238_989750242 0 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data
989750238_989750244 4 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data
989750238_989750243 1 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750243 5:44884158-44884180 GCTAAGCCCCTGCCTGCCCGGGG No data
989750238_989750241 -1 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750241 5:44884156-44884178 GTGCTAAGCCCCTGCCTGCCCGG No data
989750238_989750246 7 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750246 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
989750238_989750250 13 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750250 5:44884170-44884192 CCTGCCCGGGGTGGAGGCCCCGG No data
989750238_989750252 17 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750252 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
989750238_989750254 25 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750254 5:44884182-44884204 GGAGGCCCCGGCTGGCCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750238 Original CRISPR CCTGCGCCAGCAGCTGCAGA GGG (reversed) Intergenic