ID: 989750242

View in Genome Browser
Species Human (GRCh38)
Location 5:44884157-44884179
Sequence TGCTAAGCCCCTGCCTGCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750236_989750242 8 Left 989750236 5:44884126-44884148 CCTGCGCACCCTCTGCAGCTGCT 0: 40
1: 134
2: 218
3: 340
4: 728
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data
989750233_989750242 17 Left 989750233 5:44884117-44884139 CCCGCGGACCCTGCGCACCCTCT No data
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data
989750238_989750242 0 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data
989750232_989750242 26 Left 989750232 5:44884108-44884130 CCAGCGTGGCCCGCGGACCCTGC No data
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data
989750234_989750242 16 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data
989750235_989750242 9 Left 989750235 5:44884125-44884147 CCCTGCGCACCCTCTGCAGCTGC No data
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data
989750240_989750242 -1 Left 989750240 5:44884135-44884157 CCTCTGCAGCTGCTGGCGCAGGT No data
Right 989750242 5:44884157-44884179 TGCTAAGCCCCTGCCTGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750242 Original CRISPR TGCTAAGCCCCTGCCTGCCC GGG Intergenic
No off target data available for this crispr