ID: 989750244

View in Genome Browser
Species Human (GRCh38)
Location 5:44884161-44884183
Sequence AAGCCCCTGCCTGCCCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750234_989750244 20 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data
989750232_989750244 30 Left 989750232 5:44884108-44884130 CCAGCGTGGCCCGCGGACCCTGC No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data
989750236_989750244 12 Left 989750236 5:44884126-44884148 CCTGCGCACCCTCTGCAGCTGCT No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data
989750233_989750244 21 Left 989750233 5:44884117-44884139 CCCGCGGACCCTGCGCACCCTCT No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data
989750238_989750244 4 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data
989750235_989750244 13 Left 989750235 5:44884125-44884147 CCCTGCGCACCCTCTGCAGCTGC No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data
989750240_989750244 3 Left 989750240 5:44884135-44884157 CCTCTGCAGCTGCTGGCGCAGGT No data
Right 989750244 5:44884161-44884183 AAGCCCCTGCCTGCCCGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750244 Original CRISPR AAGCCCCTGCCTGCCCGGGG TGG Intergenic