ID: 989750246

View in Genome Browser
Species Human (GRCh38)
Location 5:44884164-44884186
Sequence CCCCTGCCTGCCCGGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750240_989750246 6 Left 989750240 5:44884135-44884157 CCTCTGCAGCTGCTGGCGCAGGT No data
Right 989750246 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
989750235_989750246 16 Left 989750235 5:44884125-44884147 CCCTGCGCACCCTCTGCAGCTGC No data
Right 989750246 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
989750234_989750246 23 Left 989750234 5:44884118-44884140 CCGCGGACCCTGCGCACCCTCTG No data
Right 989750246 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
989750238_989750246 7 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750246 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
989750233_989750246 24 Left 989750233 5:44884117-44884139 CCCGCGGACCCTGCGCACCCTCT No data
Right 989750246 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
989750236_989750246 15 Left 989750236 5:44884126-44884148 CCTGCGCACCCTCTGCAGCTGCT No data
Right 989750246 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750246 Original CRISPR CCCCTGCCTGCCCGGGGTGG AGG Intergenic