ID: 989750247

View in Genome Browser
Species Human (GRCh38)
Location 5:44884165-44884187
Sequence GCCTCCACCCCGGGCAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750247_989750262 10 Left 989750247 5:44884165-44884187 CCCTGCCTGCCCGGGGTGGAGGC No data
Right 989750262 5:44884198-44884220 CGCTCGGAGTGCGGGGCCCACGG No data
989750247_989750259 2 Left 989750247 5:44884165-44884187 CCCTGCCTGCCCGGGGTGGAGGC No data
Right 989750259 5:44884190-44884212 CGGCTGGCCGCTCGGAGTGCGGG No data
989750247_989750258 1 Left 989750247 5:44884165-44884187 CCCTGCCTGCCCGGGGTGGAGGC No data
Right 989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
989750247_989750254 -6 Left 989750247 5:44884165-44884187 CCCTGCCTGCCCGGGGTGGAGGC No data
Right 989750254 5:44884182-44884204 GGAGGCCCCGGCTGGCCGCTCGG No data
989750247_989750265 27 Left 989750247 5:44884165-44884187 CCCTGCCTGCCCGGGGTGGAGGC No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750247_989750260 3 Left 989750247 5:44884165-44884187 CCCTGCCTGCCCGGGGTGGAGGC No data
Right 989750260 5:44884191-44884213 GGCTGGCCGCTCGGAGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750247 Original CRISPR GCCTCCACCCCGGGCAGGCA GGG (reversed) Intergenic