ID: 989750248

View in Genome Browser
Species Human (GRCh38)
Location 5:44884166-44884188
Sequence GGCCTCCACCCCGGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750248_989750258 0 Left 989750248 5:44884166-44884188 CCTGCCTGCCCGGGGTGGAGGCC No data
Right 989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
989750248_989750254 -7 Left 989750248 5:44884166-44884188 CCTGCCTGCCCGGGGTGGAGGCC No data
Right 989750254 5:44884182-44884204 GGAGGCCCCGGCTGGCCGCTCGG No data
989750248_989750260 2 Left 989750248 5:44884166-44884188 CCTGCCTGCCCGGGGTGGAGGCC No data
Right 989750260 5:44884191-44884213 GGCTGGCCGCTCGGAGTGCGGGG No data
989750248_989750265 26 Left 989750248 5:44884166-44884188 CCTGCCTGCCCGGGGTGGAGGCC No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750248_989750262 9 Left 989750248 5:44884166-44884188 CCTGCCTGCCCGGGGTGGAGGCC No data
Right 989750262 5:44884198-44884220 CGCTCGGAGTGCGGGGCCCACGG No data
989750248_989750259 1 Left 989750248 5:44884166-44884188 CCTGCCTGCCCGGGGTGGAGGCC No data
Right 989750259 5:44884190-44884212 CGGCTGGCCGCTCGGAGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750248 Original CRISPR GGCCTCCACCCCGGGCAGGC AGG (reversed) Intergenic