ID: 989750251

View in Genome Browser
Species Human (GRCh38)
Location 5:44884174-44884196
Sequence CCAGCCGGGGCCTCCACCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750251_989750262 1 Left 989750251 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
Right 989750262 5:44884198-44884220 CGCTCGGAGTGCGGGGCCCACGG No data
989750251_989750268 30 Left 989750251 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
Right 989750268 5:44884227-44884249 CACCCACCCGGAACTCGTGCTGG No data
989750251_989750259 -7 Left 989750251 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
Right 989750259 5:44884190-44884212 CGGCTGGCCGCTCGGAGTGCGGG No data
989750251_989750258 -8 Left 989750251 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
Right 989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
989750251_989750265 18 Left 989750251 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750251_989750260 -6 Left 989750251 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
Right 989750260 5:44884191-44884213 GGCTGGCCGCTCGGAGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750251 Original CRISPR CCAGCCGGGGCCTCCACCCC GGG (reversed) Intergenic