ID: 989750252

View in Genome Browser
Species Human (GRCh38)
Location 5:44884174-44884196
Sequence CCCGGGGTGGAGGCCCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750236_989750252 25 Left 989750236 5:44884126-44884148 CCTGCGCACCCTCTGCAGCTGCT No data
Right 989750252 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
989750238_989750252 17 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750252 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
989750240_989750252 16 Left 989750240 5:44884135-44884157 CCTCTGCAGCTGCTGGCGCAGGT No data
Right 989750252 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
989750235_989750252 26 Left 989750235 5:44884125-44884147 CCCTGCGCACCCTCTGCAGCTGC No data
Right 989750252 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750252 Original CRISPR CCCGGGGTGGAGGCCCCGGC TGG Intergenic