ID: 989750254

View in Genome Browser
Species Human (GRCh38)
Location 5:44884182-44884204
Sequence GGAGGCCCCGGCTGGCCGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750238_989750254 25 Left 989750238 5:44884134-44884156 CCCTCTGCAGCTGCTGGCGCAGG No data
Right 989750254 5:44884182-44884204 GGAGGCCCCGGCTGGCCGCTCGG No data
989750240_989750254 24 Left 989750240 5:44884135-44884157 CCTCTGCAGCTGCTGGCGCAGGT No data
Right 989750254 5:44884182-44884204 GGAGGCCCCGGCTGGCCGCTCGG No data
989750245_989750254 -5 Left 989750245 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
Right 989750254 5:44884182-44884204 GGAGGCCCCGGCTGGCCGCTCGG No data
989750248_989750254 -7 Left 989750248 5:44884166-44884188 CCTGCCTGCCCGGGGTGGAGGCC No data
Right 989750254 5:44884182-44884204 GGAGGCCCCGGCTGGCCGCTCGG No data
989750247_989750254 -6 Left 989750247 5:44884165-44884187 CCCTGCCTGCCCGGGGTGGAGGC No data
Right 989750254 5:44884182-44884204 GGAGGCCCCGGCTGGCCGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750254 Original CRISPR GGAGGCCCCGGCTGGCCGCT CGG Intergenic