ID: 989750258

View in Genome Browser
Species Human (GRCh38)
Location 5:44884189-44884211
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750249_989750258 -4 Left 989750249 5:44884170-44884192 CCTGCCCGGGGTGGAGGCCCCGG No data
Right 989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
989750245_989750258 2 Left 989750245 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
Right 989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
989750248_989750258 0 Left 989750248 5:44884166-44884188 CCTGCCTGCCCGGGGTGGAGGCC No data
Right 989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
989750247_989750258 1 Left 989750247 5:44884165-44884187 CCCTGCCTGCCCGGGGTGGAGGC No data
Right 989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
989750251_989750258 -8 Left 989750251 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
Right 989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
989750253_989750258 -9 Left 989750253 5:44884175-44884197 CCGGGGTGGAGGCCCCGGCTGGC No data
Right 989750258 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type