ID: 989750265

View in Genome Browser
Species Human (GRCh38)
Location 5:44884215-44884237
Sequence CCACGGAGCCCACACCCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750256_989750265 4 Left 989750256 5:44884188-44884210 CCCGGCTGGCCGCTCGGAGTGCG No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750261_989750265 -5 Left 989750261 5:44884197-44884219 CCGCTCGGAGTGCGGGGCCCACG No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750249_989750265 22 Left 989750249 5:44884170-44884192 CCTGCCCGGGGTGGAGGCCCCGG No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750251_989750265 18 Left 989750251 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750255_989750265 5 Left 989750255 5:44884187-44884209 CCCCGGCTGGCCGCTCGGAGTGC No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750257_989750265 3 Left 989750257 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750253_989750265 17 Left 989750253 5:44884175-44884197 CCGGGGTGGAGGCCCCGGCTGGC No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750245_989750265 28 Left 989750245 5:44884164-44884186 CCCCTGCCTGCCCGGGGTGGAGG No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750247_989750265 27 Left 989750247 5:44884165-44884187 CCCTGCCTGCCCGGGGTGGAGGC No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data
989750248_989750265 26 Left 989750248 5:44884166-44884188 CCTGCCTGCCCGGGGTGGAGGCC No data
Right 989750265 5:44884215-44884237 CCACGGAGCCCACACCCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750265 Original CRISPR CCACGGAGCCCACACCCACC CGG Intergenic