ID: 989750268

View in Genome Browser
Species Human (GRCh38)
Location 5:44884227-44884249
Sequence CACCCACCCGGAACTCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989750251_989750268 30 Left 989750251 5:44884174-44884196 CCCGGGGTGGAGGCCCCGGCTGG No data
Right 989750268 5:44884227-44884249 CACCCACCCGGAACTCGTGCTGG No data
989750263_989750268 -10 Left 989750263 5:44884214-44884236 CCCACGGAGCCCACACCCACCCG No data
Right 989750268 5:44884227-44884249 CACCCACCCGGAACTCGTGCTGG No data
989750256_989750268 16 Left 989750256 5:44884188-44884210 CCCGGCTGGCCGCTCGGAGTGCG No data
Right 989750268 5:44884227-44884249 CACCCACCCGGAACTCGTGCTGG No data
989750261_989750268 7 Left 989750261 5:44884197-44884219 CCGCTCGGAGTGCGGGGCCCACG No data
Right 989750268 5:44884227-44884249 CACCCACCCGGAACTCGTGCTGG No data
989750257_989750268 15 Left 989750257 5:44884189-44884211 CCGGCTGGCCGCTCGGAGTGCGG No data
Right 989750268 5:44884227-44884249 CACCCACCCGGAACTCGTGCTGG No data
989750255_989750268 17 Left 989750255 5:44884187-44884209 CCCCGGCTGGCCGCTCGGAGTGC No data
Right 989750268 5:44884227-44884249 CACCCACCCGGAACTCGTGCTGG No data
989750253_989750268 29 Left 989750253 5:44884175-44884197 CCGGGGTGGAGGCCCCGGCTGGC No data
Right 989750268 5:44884227-44884249 CACCCACCCGGAACTCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989750268 Original CRISPR CACCCACCCGGAACTCGTGC TGG Intergenic