ID: 989754068

View in Genome Browser
Species Human (GRCh38)
Location 5:44930921-44930943
Sequence CCAGGGAATAAATGTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989754068_989754073 11 Left 989754068 5:44930921-44930943 CCTCCTTTACATTTATTCCCTGG No data
Right 989754073 5:44930955-44930977 TTTTTGTAGCTATTGTAAACAGG 0: 8
1: 232
2: 1259
3: 2631
4: 6544
989754068_989754074 16 Left 989754068 5:44930921-44930943 CCTCCTTTACATTTATTCCCTGG No data
Right 989754074 5:44930960-44930982 GTAGCTATTGTAAACAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989754068 Original CRISPR CCAGGGAATAAATGTAAAGG AGG (reversed) Intergenic
No off target data available for this crispr