ID: 989758852

View in Genome Browser
Species Human (GRCh38)
Location 5:44988154-44988176
Sequence AGCTATATTTTGCACTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989758849_989758852 -3 Left 989758849 5:44988134-44988156 CCCCTGAAGTATATCAAAGTAGC 0: 7
1: 78
2: 61
3: 27
4: 163
Right 989758852 5:44988154-44988176 AGCTATATTTTGCACTGTGAAGG No data
989758850_989758852 -4 Left 989758850 5:44988135-44988157 CCCTGAAGTATATCAAAGTAGCT 0: 8
1: 76
2: 57
3: 24
4: 197
Right 989758852 5:44988154-44988176 AGCTATATTTTGCACTGTGAAGG No data
989758851_989758852 -5 Left 989758851 5:44988136-44988158 CCTGAAGTATATCAAAGTAGCTA 0: 8
1: 78
2: 60
3: 28
4: 154
Right 989758852 5:44988154-44988176 AGCTATATTTTGCACTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989758852 Original CRISPR AGCTATATTTTGCACTGTGA AGG Intergenic
No off target data available for this crispr