ID: 989763854

View in Genome Browser
Species Human (GRCh38)
Location 5:45054431-45054453
Sequence ATCTTTCTAATACGTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989763849_989763854 14 Left 989763849 5:45054394-45054416 CCTCTGTCCAAATCTTTCCCATG No data
Right 989763854 5:45054431-45054453 ATCTTTCTAATACGTGAGTCTGG No data
989763851_989763854 -3 Left 989763851 5:45054411-45054433 CCCATGAAAATTAAACCAGAATC No data
Right 989763854 5:45054431-45054453 ATCTTTCTAATACGTGAGTCTGG No data
989763850_989763854 7 Left 989763850 5:45054401-45054423 CCAAATCTTTCCCATGAAAATTA No data
Right 989763854 5:45054431-45054453 ATCTTTCTAATACGTGAGTCTGG No data
989763852_989763854 -4 Left 989763852 5:45054412-45054434 CCATGAAAATTAAACCAGAATCT No data
Right 989763854 5:45054431-45054453 ATCTTTCTAATACGTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989763854 Original CRISPR ATCTTTCTAATACGTGAGTC TGG Intergenic
No off target data available for this crispr