ID: 989764122

View in Genome Browser
Species Human (GRCh38)
Location 5:45059195-45059217
Sequence CAGAATATCCCAAAAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989764122_989764126 3 Left 989764122 5:45059195-45059217 CCCAGCTCTTTTGGGATATTCTG No data
Right 989764126 5:45059221-45059243 TAGGTAGGCCTTACATTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989764122 Original CRISPR CAGAATATCCCAAAAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr