ID: 989767278

View in Genome Browser
Species Human (GRCh38)
Location 5:45102534-45102556
Sequence CTTCCCTACATGACATAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989767278_989767280 23 Left 989767278 5:45102534-45102556 CCACCTTATGTCATGTAGGGAAG No data
Right 989767280 5:45102580-45102602 GTTTTCTCATCTGCACAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989767278 Original CRISPR CTTCCCTACATGACATAAGG TGG (reversed) Intergenic
No off target data available for this crispr