ID: 989776132

View in Genome Browser
Species Human (GRCh38)
Location 5:45208766-45208788
Sequence TATCCAATCCAATTTGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
989776132_989776139 27 Left 989776132 5:45208766-45208788 CCAGGATCAAATTGGATTGGATA No data
Right 989776139 5:45208816-45208838 AGGTAGGTAACTTTTGAAAATGG No data
989776132_989776136 7 Left 989776132 5:45208766-45208788 CCAGGATCAAATTGGATTGGATA No data
Right 989776136 5:45208796-45208818 GGACTGGATTTAGAGGCCTCAGG No data
989776132_989776137 11 Left 989776132 5:45208766-45208788 CCAGGATCAAATTGGATTGGATA No data
Right 989776137 5:45208800-45208822 TGGATTTAGAGGCCTCAGGTAGG No data
989776132_989776134 -9 Left 989776132 5:45208766-45208788 CCAGGATCAAATTGGATTGGATA No data
Right 989776134 5:45208780-45208802 GATTGGATAATTAGCTGGACTGG No data
989776132_989776135 0 Left 989776132 5:45208766-45208788 CCAGGATCAAATTGGATTGGATA No data
Right 989776135 5:45208789-45208811 ATTAGCTGGACTGGATTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
989776132 Original CRISPR TATCCAATCCAATTTGATCC TGG (reversed) Intergenic
No off target data available for this crispr